Biology - Online Test
Q1. The sequence of events mentioned below is symbolized by alphabets. Choose the correct answer where the alphabets are matched with the processes.
RNA —(A)—> DNA —(B)—> DNA —(C)—> mRNA —(D)—> Polypeptide
Answer : Option C
Explaination / Solution:
The sequences of event are as follows, RNA of retrovirus change into DNA by reverse transcription. Replication of DNA produces more DNA. The DNA produce m-RNA by transcription process and m-RNA translates into specific protein.
Q2. Signal of parturition originate from
Answer : Option C
Explaination / Solution:
The signal of parturition (labour pain) originates from the placenta and movement of foetus. Some hormones like oxytocin generates ejection reflex for parturition.
Q3. During transcription, RNA polymerase holoenzyme binds to a gene promoter and assumes a saddle-like structure. What is its DNA-binding sequence?
Answer : Option D
Explaination / Solution:
Our protein-coding genes have a characteristic sequence of nucleotides, termed the TATA box, in front of the start site of transcription. The typical sequence is something like T-A-T-A-a/t-A-a/t, where a/t refers to positions that can be either A or T.
The TATA-binding protein (sometimes referred to as TBP) recognizes this TATA sequence and binds to it, creating a landmark that marks the start site of transcription
Q4. Hormone responsible for milk ejection after the birth of baby is:-
Answer : Option D
Explaination / Solution:
Lactiferous glands present inside the mammary gland start producing milk due to release of hormone oxytocin from pituitary glands.
Q5. If one strand of DNA has the nitrogenous base sequence as ATCTG, what would be the complementary RNA strand sequence?
Answer : Option A
Explaination / Solution:
If nitrogenous base sequence of DNA is as ATCTG. The complementary RNA strand should be UAGAC. Thymine of DNA is replaced by uracil (U) in RNA.
Q6. Phenomenal and rapid increase of population in a short period is called
Answer : Option C
Explaination / Solution:
Rapid increase of population in a short period of time is called population explosion. It can be checked by using contraceptive methods.
Q7. If the sequence of one strand of DNA is
5'-ATGCATGCATGCATGCATGCATGCATGC-3' than it complementary strand have sequence as
Answer : Option C
Explaination / Solution:
The DNA strands are complementary to each other with respect to base sequence.
Hence, if the sequence of one strand of DNA is 5'- ATGCATGCATGCATGCATGCATGCATGC − 3’
Then, the sequence of complementary strand in direction will be 3'- TACGTACGTACGTACGTACGTACGTACG − 5’ .
Therefore, the sequence of nucleotides on DNA polypeptide in direction is 5'- GCATGCATGCATGCATGCATGCATGCAT− 3’
Q8. Which one is called pregnancy hormone
Answer : Option D
Explaination / Solution:
progesterone is called pregnancy hormone because it helps in maintaining pregnancy.
Q9. The sequence of nitrogen bases in a particular region of the noncoding strand of a DNA molecule was found to be CAT GTT TAT CGC.
What would be the sequence of nitrogen bases in the mRNA that is synthesized by the corresponding region of the coding strand in that DNA?
Answer : Option D
Explaination / Solution:
The RNA copy from one section of DNA, which usually corresponds to a single gene, is called messenger RNA (mRNA).
The 2 strands of the DNA molecule are temporarily split by enzymes which cause a short part to be copied into a similarly short section of RNA molecule. The copying is along the same lines as already explained, (A for T, G for C, C for G) except that a different base called U (uracil) replaces T (thymine). So the sequence will be CAU GUU UAU CGC
Q10. Foetal ejection reflex in human female is induced by
Answer : Option D
Explaination / Solution:
When baby developing within the uterus fully developed, foetal ejection reflex is induced for parturition of the baby through birth canal. Foetal ejection reflex is induced by hormone oxytocin released from pituitary glands.
