Zoology - Online Test
The DNA strands are complementary to each other with respect to base sequence.
Hence, if the sequence of one strand of DNA is 5'- ATGCATGCATGCATGCATGCATGCATGC − 3’
Then, the sequence of complementary strand in direction will be 3'- TACGTACGTACGTACGTACGTACGTACG − 5’ .
Therefore, the sequence of nucleotides on DNA polypeptide in direction is 5'- GCATGCATGCATGCATGCATGCATGCAT− 3’
Assertion: UAA codon is a termination codon.
Reason: If in a mRNA, a termination codon is present, the protein synthesis stops abruptly whether the protein synthesis is complete or not.
Reason: mRNA is transferred from the nucleus into the cytoplasm where ribosomes and amino acids are available for protein synthesis.
Synthesis of RNA from DNA is called transcription and it occurs in the nucleus of eukaryotic cells.
DNA replication occurs in the cytoplasm of prokaryotes and in the nucleus of eukaryotes. Regardless of where DNA replication occurs, the basic process is the same.
Synthesis of protein from RNA is called translation and it occurs in the cytoplasm of eukaryotic cells.
messenger RNA (mRNA) is a molecule in cells that carries codes from the DNA in the nucleus to the sites of protein synthesis in the cytoplasma (ribosome) where they can be joined together in specific order to make a specific protein.