Molecular Basis of Inheritance - Online Test
Q1. During replication of DNA, Okazaki fragments are formed in the direction of :
Answer : Option B
Explaination / Solution:
During replication of double helix DNA, one strands having 3’ to 5’ polarity it is continuous and on other strand it is in small fraction called Okazaki fragments. The polarity of this strand is 5’ to 3’.
Q2. The sequence of events mentioned below is symbolized by alphabets. Choose the correct answer where the alphabets are matched with the processes.
RNA —(A)—> DNA —(B)—> DNA —(C)—> mRNA —(D)—> Polypeptide
Answer : Option C
Explaination / Solution:
The sequences of event are as follows, RNA of retrovirus change into DNA by reverse transcription. Replication of DNA produces more DNA. The DNA produce m-RNA by transcription process and m-RNA translates into specific protein.
Q3. During transcription, RNA polymerase holoenzyme binds to a gene promoter and assumes a saddle-like structure. What is its DNA-binding sequence?
Answer : Option D
Explaination / Solution:
Our protein-coding genes have a characteristic sequence of nucleotides, termed the TATA box, in front of the start site of transcription. The typical sequence is something like T-A-T-A-a/t-A-a/t, where a/t refers to positions that can be either A or T.
The TATA-binding protein (sometimes referred to as TBP) recognizes this TATA sequence and binds to it, creating a landmark that marks the start site of transcription
Q4. If one strand of DNA has the nitrogenous base sequence as ATCTG, what would be the complementary RNA strand sequence?
Answer : Option A
Explaination / Solution:
If nitrogenous base sequence of DNA is as ATCTG. The complementary RNA strand should be UAGAC. Thymine of DNA is replaced by uracil (U) in RNA.
Q5. If the sequence of one strand of DNA is
5'-ATGCATGCATGCATGCATGCATGCATGC-3' than it complementary strand have sequence as
Answer : Option C
Explaination / Solution:
The DNA strands are complementary to each other with respect to base sequence.
Hence, if the sequence of one strand of DNA is 5'- ATGCATGCATGCATGCATGCATGCATGC − 3’
Then, the sequence of complementary strand in direction will be 3'- TACGTACGTACGTACGTACGTACGTACG − 5’ .
Therefore, the sequence of nucleotides on DNA polypeptide in direction is 5'- GCATGCATGCATGCATGCATGCATGCAT− 3’
Q6. The sequence of nitrogen bases in a particular region of the noncoding strand of a DNA molecule was found to be CAT GTT TAT CGC.
What would be the sequence of nitrogen bases in the mRNA that is synthesized by the corresponding region of the coding strand in that DNA?
Answer : Option D
Explaination / Solution:
The RNA copy from one section of DNA, which usually corresponds to a single gene, is called messenger RNA (mRNA).
The 2 strands of the DNA molecule are temporarily split by enzymes which cause a short part to be copied into a similarly short section of RNA molecule. The copying is along the same lines as already explained, (A for T, G for C, C for G) except that a different base called U (uracil) replaces T (thymine). So the sequence will be CAU GUU UAU CGC
Q7.
Assertion: UAA codon is a termination codon.
Reason: If in a mRNA, a termination codon is present, the protein synthesis stops abruptly whether the protein synthesis is complete or not.
Answer : Option C
Explaination / Solution:
UAA of mRNA do not code for any amino acids so it is a termination codon. If termination codon is present on mRNA, the protein synthesis stops abruptly at that point.
Q8. Assertion: Replication and transcription occur in the nucleus but translation occurs in the cytoplasm.
Reason: mRNA is transferred from the nucleus into the cytoplasm where ribosomes and amino acids are available for protein synthesis.
Reason: mRNA is transferred from the nucleus into the cytoplasm where ribosomes and amino acids are available for protein synthesis.
Answer : Option B
Explaination / Solution:
Synthesis of RNA from DNA is called transcription and it occurs in the nucleus of eukaryotic cells.
DNA replication occurs in the cytoplasm of prokaryotes and in the nucleus of eukaryotes. Regardless of where DNA replication occurs, the basic process is the same.
Synthesis of protein from RNA is called translation and it occurs in the cytoplasm of eukaryotic cells.
messenger RNA (mRNA) is a molecule in cells that carries codes from the DNA in the nucleus to the sites of protein synthesis in the cytoplasma (ribosome) where they can be joined together in specific order to make a specific protein.
Q9. Transcription is the coping of genetic information form DNA to mRNA and translation is the formation of polypeptide chain according to code to form protein. Which one follows the other?
Answer : Option C
Explaination / Solution:
In central dogma, transcription is the copying of genetic information present on a DNA to mRNA. This mRNA is used as template to produce protein by the process of translation. Thus, translation is always followed by transcription.
Q10. Number of nitrogenous bases in a Codon is
Answer : Option A
Explaination / Solution:
A codon is a sequence of 3 nitrogenous bases located on mRNA that will pair up with the anticodon of tRNA to make the polypeptide (protein) I. 64 codons can be obtained from four nitrogenous bases if arranged in group of 3.
