CBSE 12TH BIOLOGY - Online Test

Answer : Option C
Explaination / Solution:

The DNA strands are complementary to each other with respect to base sequence.

Hence, if the sequence of one strand of DNA is 5'- ATGCATGCATGCATGCATGCATGCATGC − 3’

Then, the sequence of complementary strand in direction will be 3'- TACGTACGTACGTACGTACGTACGTACG − 5’ .

Therefore, the sequence of nucleotides on DNA polypeptide in direction is 5'- GCATGCATGCATGCATGCATGCATGCAT− 3’

Answer : Option D
Explaination / Solution:

progesterone is called pregnancy hormone because it helps in maintaining pregnancy.

Answer : Option D
Explaination / Solution:

The RNA copy from one section of DNA, which usually corresponds to a single gene, is called messenger RNA (mRNA). The 2 strands of the DNA molecule are temporarily split by enzymes which cause a short part to be copied into a similarly short section of RNA molecule. The copying is along the same lines as already explained, (A for T, G for C, C for G) except that a different base called U (uracil) replaces T (thymine). So the sequence will be CAU GUU UAU CGC

Answer : Option D
Explaination / Solution:

When baby developing within the uterus fully developed, foetal ejection reflex is induced for parturition of the baby through birth canal. Foetal ejection reflex is induced by hormone oxytocin released from pituitary glands.

Answer : Option C
Explaination / Solution:

UAA of mRNA do not code for any amino acids so it is a termination codon. If termination codon is present on mRNA, the protein synthesis stops abruptly at that point.

Answer : Option B
Explaination / Solution:

After parturition, mammary glands start producing milk. The yellowish coloured milk is called colostrums. This milk contains antibodies that provide immunity to newly born baby.

Answer : Option B
Explaination / Solution:

Synthesis of RNA from DNA is called transcription and it occurs in the nucleus of eukaryotic cells.

DNA replication occurs in the cytoplasm of prokaryotes and in the nucleus of eukaryotes. Regardless of where DNA replication occurs, the basic process is the same.

Synthesis of protein from RNA is called translation and it occurs in the cytoplasm of eukaryotic cells.

messenger RNA (mRNA) is a molecule in cells that carries codes from the DNA in the nucleus to the sites of protein synthesis in the cytoplasma (ribosome) where they can be joined together in specific order to make a specific protein.

Answer : Option C
Explaination / Solution:

After the birth of child, lactation starts in the mammary glands. The milk released in initial few days is called colostrum. Colostrum contains IgA antibodies that provide immunity to disease.

Answer : Option C
Explaination / Solution:

In central dogma, transcription is the copying of genetic information present on a DNA to mRNA. This mRNA is used as template to produce protein by the process of translation. Thus, translation is always followed by transcription.

Answer : Option B
Explaination / Solution:

Several memory ducts join to form wider memory ampulla which is connected to lactiferous ducts through which milk is sucked out.